PNA HyBeacons for analysis of human mutations related to statin-induced myopathy (2024)

Journal List
Artif DNA PNA XNA
PMC3324338

As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsem*nt of, or agreement with, the contents by NLM or the National Institutes of Health.
Learn more: PMC Disclaimer | PMC Copyright Notice

Artif DNA PNA XNA. 2011 Jul 1; 2(3): 79–89.

doi:10.4161/adna.18179

PMCID: PMC3324338

PMID: 22567191

Nittaya Gale,¹ Petr Kocalka,² Charlotte Mardle,² and Tom Brown²

Author information Copyright and License information PMC Disclaimer

Abstract

Aminoalkyl and alkyne-tagged PNA HyBeacons have been synthesized, labeled with fluorescein via conventional amide bond or triazole formation (click chemistry) and used to detect single nucleotide polymorphisms (SNPs) implicated in statin-induced myopathy. The PNA HyBeacons gave much better mismatch/mutant discrimination than conventional DNA HyBeacons but smaller fluorescence changes on melting.

Keywords: fluorescence melting, genetic analysis, HyBeacon, PNA, SNPs, statin-induced myopathy

Introduction

Fluorogenic PCR¹ using Taqman probes,² Scorpions,³ and Molecular Beacons⁴ is an important technology in genetic analysis and diagnostics. Recent developments in high resolution melting analysis promise to revolutionise the field by adding an extra level of information,⁵ hence probe-based methods that are fully compatible with this technique are becoming increasingly important. HyBeacon probes⁶ (Fig.1) are ideally suited for post-PCR melting analysis as their fluorescence emission changes greatly on duplex melting. Moreover, in the context of melting analysis, HyBeacons have advantages over other probe based methods as they are devoid of secondary structure.

Open in a separate window

Figure1.

HyBeacon principle: In the unhybridized HyBeacon (A) the two fluorophores (black circles) interact and fluorescence is quenched. Binding to complementary target strand (B) leads to a highly fluorescent duplex (C).

Methods to increase the difference in thermodynamic stability between fully matched and mismatched probe-target duplexes⁷^,⁸ are particularly valuable in forensic analysis, genetic testing and SNP detection by melting analysis. As PNA is known to give better mismatch discrimination than DNA,⁹ we decided to synthesize and evaluate PNA HyBeacons. A convenient synthesis of fluorescein PNA HyBeacons was developed using two labeling strategies (Fig.2); click chemistry, the copper-catalyzed azide-alkyne cycloaddition (CuAAC reaction), and amide bond formation. Click chemistry¹⁰ has previously been used to label PNA,¹¹ and is recognized for its high efficiency, whereas amide bond formation is a conventional technique for labeling amino-functionalised DNA¹²^,¹³ and PNA. The major advantage of click chemistry over other labeling methods is the very high reactivity of alkynes with azides, and their lack of reactivity with almost all other functional groups.

Open in a separate window

Figure2.

Modified PNA thymine monomers and PNA HyBeacon probes. 1, alkyne-T-PNA monomer; 2, aminoalkyl-T-PNA monomer; 3, 5-azidohexylfluorescein. Boxes: PNA HyBeacon containing triazole and amide bond linkages, FAM = fluorescein.

In this paper we describe an effective synthetic route to modified alkyne and amine-modified PNA monomers 1 and 2 and azidohexylfluorescein 3. In addition, we have evaluated PNA HyBeacons by probing single nucleotide polymorphisms (SNPs) at the Rs4149056 locus of the human genome that are correlated with statin-induced myopathy in high risk individuals.¹⁴

Results and Discussion

Synthesis of alkyne-T-PNA monomer 1 The synthesis of alkyne-T-PNA monomer 1 was accomplished according to ^{Scheme 1}. Synthesis of the PNA backbone 4 using 2,4-dinitrosulfonamide chemistry was efficient and straightforward.¹⁵^,¹⁶ Alkylation of iodouracil with ethyl bromoacetate followed by Sonogashira coupling gave compound 6 in 75% overall yield. After hydrolysis of ester 6, carboxylic acid 7 was coupled to PNA backbone 4 to afford the fully protected PNA monomer 8 in 92% yield. Finally the tert-butyl ester of 8 was cleaved in acid to yield the monomer 1 in 78% yield (2:1 rotamers).

Open in a separate window

Scheme 1.

Synthesis of alkyne-T-PNA monomer 1: i) BrCH₂CO₂Et, K₂CO₃, DMF, 2 h, rt, 89%; ii) 1,7-octadiyne, CuI, Et₃N, Pd(Ph₃)₄, DMF, rt, 2 h, 82%; iii) LiOH, 1,4 dioxane/H₂O (2:1, v/v), rt, 30 min, Dowex 50 (H⁺), 82%; iv) HBTU, DIPEA, DMF, 3 h, 92%; v) 95:2.5:2.5, TFA:water:TIS (v/v), 30 min, rt, 78%.

Synthesis of aminoalkyl-T-PNA monomer 2 (^{Scheme 2}). The modified base moiety of aminoalkyl-T-PNA monomer 2 was synthesized from propargylamine, iodouracil and 6-aminohexanoic acid. The first two steps were similar to alkyne-T-PNA monomer 1, briefly N-Boc-protected propargylamine 9¹⁷ was coupled to modified iodouracil 5 via a Sonogashira coupling after which hydroysis of the ethyl ester under basic conditions gave the pure product in 82% yield over two steps. Compound 10 was coupled to PNA backbone 4 using PyBOP activator after which the Boc and ^tBu protecting groups of 11 were removed using trifluoroacetic acid to give compound 12. The free amino group of 12 was then coupled to N-Boc-aminohexanoic acid NHS ester 13¹⁸ to give the aminoalkyl-T-PNA monomer 2 in 63% yield (2:1 rotamers).

Open in a separate window

Scheme 2.

Synthesis of aminoalkyl-T-PNA monomer 2: i) Pd(PPh₃)₄, CuI, DMF, Et₃N, 2 h, 90%; ii) LiOH, water/MeOH (1:3, v/v), 45 min, rt, then Dowex 50 (H⁺)/pyridine, 91%; iii) PyBOP, HOBt, 4, DIPEA, DMF, rt, 3 h, 63%; iv) 95:2.5:2.5, TFA:water:TIS (v/v), 30 min, rt, 95%; v) DIPEA, DMF, 4 h, 63%.

Synthesis of 5-azidohexylfluorescein 3. The synthesis of 5-azidohexylfluorescein 3 was achieved from the inexpensive, commercially-available precursors 6-aminohexanol and 5(6)-carboxyfluorescein in good yield (^{Scheme 3}). 6-Aminohexanol was protected at the N-terminus using ethyl trifluoroacetate, followed by conversion of the alcohol to azide via tosyl derivative 15 to give compound 16. The trifluoroacetyl protecting group at the N-terminus was then removed with aqueous ammonia to give amine 17 which was coupled to the carboxyfluorescein dye 18¹⁹ using EDC chemistry giving, after purification, 5-azidohexylfluorescein 19 as a major product (24%) along with 6-azidohexylfluorescein (< 5%). Finally, the pivaloyl groups of compound 19 were removed under basic conditions using a mixture of ammonium hydroxide and 1,4-dioxane.

Open in a separate window

Scheme 3.

Synthesis of 5-azidohexylfluorescein 3 i) CF₃CO₂Et, DMAP, CH₂Cl₂ rt, 1 h; ii) tosyl chloride, Et₃N, CH₂Cl₂, rt, 5 h, 70% for 2 steps; iii) K₂CO₃, DMF, NaN₃, 50 °C, 5 h, 94%; iv) 35% NH₄OH, 12 h, rt, then Dowex 50 (H⁺), 76%; v) EDC, HOBt, rt, 1 h, 24%; vi) 1,4- dioxane/NH₄OH (1:2, v/v), rt, 3.5 h, then Dowex 50 (H⁺), 93%.

PNA design and synthesis of PNA HyBeacon probes. To investigate the properties of PNA HyBeacons, a series of fluorescently labeled PNA probes for the human Rs4149056 target were synthesized using the following resource: (www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=rs4149056) The wild-type probes (WP) contain thymine at the site of polymorphism and the mutant probes (MP) contain cytosine (Table 1).

Table1.

PNA and DNA sequences, melting temperatures (T_ms), quantum yields and MS analyses

Oligo	Sequence	T_m (°C)		ΔT_m	Quantum yield*^a		MALDI/ES+ (Da)
ID	Sequence	Wt(A)	Mt(G)	(°C)	ssDNA	dsDNA	Found	Calc.
	HyBeacon Probes
WP3Am	acGATATAfGTGfTCATGO	60.6	51.3	9.3	0.170	0.238 (T:A)	5750.9	5750.1
WP6Am	acGATAfATGTGTfCATGO	60.4	53.6	6.8	0.155	0.252 (T:A)	5752.7	5751.4
WP6Cl	GATAYATGTGTYCATGKKK	62.0	53.9	8.1	0.061	0.133 (T:A)	5969.0	5969.7
WP32Am	acGATAfATGfGTfCATGO	58.6	54.3	4.3	0.133	0.185 (T:A)	6260.1	6259.3
WP32Cl	GATAYATGYGTYCATGKKK	62.0	56.3	5.7	0.034	0.107 (T:A)	6559.4	6560.8
MP3Am	acGATATAfGCGfTCATGO	48.5	63.3	-14.8	0.279	0.282 (C:G)	5737.5	5735.1
MP3Cl	GATATAYGCGYTCATGKKK	49.0	63.7	-14.7	0.026	0.050 (C:G)	5952.5	5954.7
MP6Cl	GATAYATGCGTYCATGKKK	50.1	64.2	-14.1	0.206	0.223 (C:G)	5955.6	5954.7
MP6Cl2	OATAYATGCGTYCATKK	36.0	53.2	-17.2	0.075	0.169 (C:G)	5535.7	5533.4
WP6Cl2	OATAYATGTGTYCATKK	47.5	38.6	8.9	0.083	0.140 (T:A)	5548.6	5548.4
MP DNA	GTGGATATAFGCGFTCATGGP	43.0	52.0	9.0	0.070	0.204 (C:G)	nd	nd
Wtt	GGAATCTGGGTCATACATGTGGATATATGTGTTCATGGGTAATATGCTTCGTGGAATAG
Mtt	As Wtt template but with C instead of T
FP	GAATCTGGGTCATACATG
RP	TATTCCACGAAGCATATT
	*PNA before labeling with dye^b**				*ΔT_m ^c**
WP3U2	acGATATA2GTG2TCATGO	67.6	58.9	9.7		7.0
WP6U2	acGATA2ATGTGT2CATGO	68.1	59.1	9.0		7.7
WP6U1	GATA1ATGTGT1CATGKKK	67.6	58.9	8.7		8.7
WP32U2	acGATA2ATG2GT2CATGO	70.3	63.2	7.1		11.7
WP32U1	GATA1ATG1GT1CATGKKK	66.6	60.4	6.2		4.6
MP3U2	acGATATA2GCG2TCATGO	58.0	71.2	-13.2		7.9
MP3U1	GATATA1GCG1TCATGKKK	55.7	69.4	-13.7		5.7
MP6U1	GATA1ATGCGT1CATGKKK	57.8	71.7	-13.9		7.5
MP6U2	OATAYATGCGTYCATKK
WP6U2	OATAYATGTGTYCATKK
synth Mt	CCATGAACGCATATATCC
synth Wt	CCATGAACACATATATCC

Open in a separate window

WP and MP, wild-type and mutant probes; Am and Cl, probe labeling via amide bond and click chemistry; Wtt and Mtt, wild-type and mutant templates/targets (Wt) “A” and mutant (Mt) target “G”; FP and RP, forward and reverse primers; U1 and U2, PNA with alkyne-T-monomer 1 and aminoalkyl-T-monomer 2 before labeling with fluorescent dyes; synth Wt and synth Mt, synthetic wild-type and synthetic mutant targets; ac, acetyl; O, double aminoethoxyethoxyacetyl; K, lysine; f, fluorescein with aminoalkyl-T-PNA monomer 2; Y, alkyne-T-PNA monomer 1 clicked to 5-azidohexylfluorescein 3; F, fluorescein dT (Glen Research); P, phosphate; 1, alkyne-T-PNA monomer; 2, aminoalkyl-T-PNA monomer; The SNPs are underlined in blue; ss and ds, single and double stranded DNA; *a, quantum yield is an average of 10 measurements; Calc, calculated mass; T_ms, T_m of the HyBeacon probe was measured with PCR products of Wtt and Mtt whereas T_m of the PNA before labeling was measured with synthetic Mt and Wt targets (*b); ΔT_m, T_m of (Wt-Mt); *c, (T_m of PNA and synthetic target before labeling with dye) – (T_m of PNA and synthetic target after fluorescent labeling)

Each PNA HyBeacon contains two or three fluorescein dyes with different spacings between them. Multiple fluorescent dyes are essential for HyBeacon to produce effective melting curves. PNA probes containing monomers 1 and 2 were synthesized by standard Fmoc solid-phase PNA synthesis methods and conjugation to the corresponding functionalised fluorescein PNAs was performed both in solution and on solid phases via click chemistry and amide bond formation.

In the click fluorescein labeling reaction under both solid and solution phase reaction conditions the ratio of alkyne PNA: 5-azidohexylfluorescein 3: copper sulfate: sodium ascorbate was 1:50:10:100 and in all cases the conversion was more than 80%. Dye-labeling via amide bond formation was performed by mixing 6-carboxyfluorescein succinimidyl ester with PNA containing free amino groups on aminoalkyl-T-PNA monomer 2 in a mixture of DMF: aqueous buffer (0.5 M NaHCO₃/Na₂CO₃, 1:1, v/v, pH 8.75). The reactions were left at room temperature for 4–6 h and afforded the products in ~80% yield (calculated by RP-HPLC analysis). The purity of the crude PNA before and after labeling with three units of the modified PNA monomers was slightly lower than with two units. This is a consequence of less than quantitative coupling due to the bulk of fluorescein and the proximity of the modified bases. Example of RP-HPLC traces of PNA before and after labeling with fluorescein (amide bond formation) with three additions of the aminoalkyl-T-PNA monomer 2 and after click labeling with two additions of alkyne-T-PNA monomer 1 in solution phase are shown in Figure3. The RP-HPLC of the crude PNA before labeling with the fluorescent dye shows the purity to be 70–80%. The product distribution after labeling in solution for three additions of the modified aminoalkyl-T-PNA monomer 2 with 6-carboxyfluorescein succinimidyl ester at positions 5, 9 and 12 (WP32Am) was 80% of the desired product and 15% of incomplete labeled products containing two fluorescein units. The click reaction to insert two additions of fluorescein at positions 5 and 12 went almost to completion (> 98%, WP6Cl2).

Open in a separate window

Figure3.

RP-HPLC of PNA probes on C18 column A) Unpurified triply amine-labeled WP32U2, B) Unpurified triple fluorescein-labeled WP32Am, C) Unpurified doubly alkyne-labeled WP6U2, D) Unpurified doubly fluorescein-labeled WP6Cl2 where 1 = unlabeled PNA, 2 = incomplete labeling, 3 = correct product, 4 = free dye. A and B, UV absorbance at 270nm (analytical) C and D at 300nm (preparative). A and B show the gradient of buffer B. Buffer A = 0.1% TFA in water and buffer B = 0.08% TFA in MeCN.

Fluorescence melting studies. Melting analyses (Table 1) were performed to evaluate the PNA HyBeacons using wild-type and mutant synthetic DNA targets (Wtt and Mtt) with adenine and guanine respectively at the site of polymorphism. Asymmetric PCR amplification and post-PCR melting analysis was also performed using a 10:1 ratio of primers RP:FP to produce excess of the target strand for the HyBeacon probes. These experiments were performed on a Roche LightCycler 1.5 and required a total of 60 min to complete the assay (50 min for PCR and 10 min for melting analysis). The fluorescein PNA HyBeacons with click triazole and amide linkages gave similar T_ms (Fig.4), but the melting peaks of the fluorescein amide PNA HyBeacons were slightly sharper than the triazole analogs. The T_ms of mutant probes where the C base in the probe binds to mutant target (C:G base pair), were much higher (ΔT_m = 17°C) than that of the wild-type target (C:A mismatch). For the wild-type probe with thymine at the point of discrimination (wild-type: target = T:A, mutant: target = T:G) the difference in T_m was 9°C. This is excellent discrimination considering the fact that TA is the least stable Watson-Crick base pair and GT is a relatively stable mismatch.

Open in a separate window

Figure4.

Comparison of melting peaks of duplexes between PNA probes and asymmetric PCR products of Mtt and Wtt oligonucleotide targets. Probes were labeled by amide bond formation (Am) or click chemistry (Cl). WP = wild-type probe that contains a “T” base at the SNP. MP = mutant probe that contains a “C” base at the SNP. T:A = wild-type probe/wild-type target, T:G = wild-type probe/mutant target, C:A = mutant probe/wild-type target and C:G = mutant probe/mutant target.

Conclusions

Fluorescein-labeled PNA HyBeacons have been synthesized by two methods; by click chemistry to create a triazole linkage, and by NHS ester-amine coupling for amide bond formation. In principle these approaches could be combined to offer orthogonality for labeling PNA with different dyes or other reporter groups at specific loci in the sequence. PNA HyBeacons give superior mismatch discrimination to DNA HyBeacons but much smaller fluorescence change on melting. The origin of the weaker fluorecence change is under investigation.

Materials and Methods

General

Reactions which required a dry atmosphere were conducted in flame-dried glassware under argon gas. Unless otherwise stated, commercial grade solvents and reagents were used without further purification. Tetrahydrofuran (THF) was distilled from sodium using benzophenone as an indicator. Triethylamine, pyridine, N,N diisopropylethylamine (DIPEA) and dichloromethane (DCM) were distilled from CaH₂. Thin Layer Chromatography (TLC) which was performed on aluminum sheets coated with silica gel (0.22 mm thickness, aluminum backed, Merck) containing fluorescent indicator 60F₂₅₄. Visualization was achieved by UV radiation at 254nm and in some cases an additional reagent, i.e., ninhydrin for amines, potassium permanganate for unsaturated compounds and Mary reagent for acids. Purification using column chromatography was performed with chromatography grade Silica gel 60A (particle size 35–70 μL and pore size 60 Å). NMR spectra were recorded using a Brüker AV 300 spectrometer or a Brüker DPX400 spectrometer. Proton-proton correlation (H-H COSY), carbon-proton correlation (C-H COSY) and DEPT-135 methods were also used to assign the spectra. Chemical shifts (δ) are given in ppm and J values are given in Hz and are correct to within 0.5 Hz. All spectra were internally referenced to the appropriate residual undeuterated solvent signal. The following abbreviations apply: “s” for singlet, “d” for doublet, “t” for triplet, “q” for quarter “br” for broad, “obsc” for obscure and “m” for multiplet. Low-resolution mass spectra (LRMS) were recorded using the electrospray technique on a Fisons VG platform instrument or a Waters ZMD quadrupole instrument. High-resolution mass spectra (HRMS) were recorded using the electrospray technique on a Bruker APEX III FT-ICR mass spectrometer.

ethyl (5-iodouracil-1-yl)acetate, 5 Potassium carbonate (6.28 g, 45.8 mmol) was added to a solution of 5-iodouracil (9.90 g, 41.6 mmol) in anhydrous N,N-dimethylformamide (80 mL) under argon, followed by slow addition of ethyl-bromoacetate (4.52 g, 40.8 mmol). The reaction mixture was stirred at room temperature and after 2 h, filtered through a pad of Celite, concentrated by co-evaporation with toluene (20 mL × 3) and purified by precipitation using dichloromethane and diethyl ether to yield the title product as an amorphous white solid (11.79 g, 89%). δ_Η (300 MHz, CDCl₃) 8.84 (1H, s, NH), 7.58 (1H, s, NCH), 4.48 (2H, s, NCH₂), 4.31–4.24 (2H, q, J = 7.0 Hz, OCH₂), 1.34–1.30 (3H, t, J = 7.0 Hz, CH₃); δ_C (75.5 MHz, DMSO-d₆) 167.0 (C), 160.1 (C), 150.2 (C), 148.6 (CH), 68.4 (C), 62.5 (CH₂), 48.8 (CH₂), 14.1 (CH₃); LRMS-ESI⁺: m/z 324.9 [M+H]⁺(100%).

ethyl [5-(1,7-octadiynyl) uracil]acetate, 6 To a thoroughly degassed solution of ethyl (5-iodouracil-1-yl) acetate 5 (7.78 g, 24.0 mmol) in anhydrous N,N-dimethylformamide (100 mL) was added successively anhydrous triethylamine (10 mL), 1,7-octadiyne (3.82 mL, 36.0 mmol), tetrakis(triphenylphosphine)palladium(0) (2.80 g, 2.4 mmol) and copper (I) iodide (914 mg, 4.8 mmol). The mixture was left to stir under argon. After 2 h the reaction mixture was poured into a mixture of saturated ammonium chloride (75 mL) and EDTA (Na⁺ salt, 4.50 g in water 300 mL pH 8). The mixture was extracted with ethyl acetate (100 mL × 4) and the combined organic extracts were dried over sodium sulfate and filtered. The filtrate was concentrated in vacuo by co-evaporation with toluene (20 mL × 3) and the residue was purified by flash column chromatography eluting with 20% petroleum ether in dichloromethane graded to 2% methanol in dichloromethane, to give ethyl (5-octa-1,7-diynyl)acetate 6 as an amorphous white powder (5.94 g, 82%). δ_Η (300 MHz, DMSO-d₆) 11.7 (1H, s, NH), 7.98 (1H, s, NCH), 4.50 (2H, s, NCH₂), 4.19–4.12 (2H, q, J = 7.0 Hz, OCH₂), 2.77 (1H, t, J = 3 Hz, CCH), 2.40 (2H, m, CCCH₂), 2.20 (2H, m, CH₂CCH), 1.57 (4H, m, (CH₂CH₂CH₂CCH), 1.20 (3H, t, J = 7.0 Hz, CH₃); δ_C (75.5 MHz, DMSO-d₆) 167.8 (C), 162.2 (C), 149.9 (C), 148.2 (CH), 98.2 (C), 92.9 (C), 84.2 (C), 72.5 (C), 71.3 (CH), 61.3 (CH₂), 48.7 (CH₂), 27.2 (CH₂), 27.1 (CH₂), 18.2 (CH₂), 17.2 (CH₂), 14.0 (CH₃); LRMS-ESI⁺: m/z 342.5 [M+K]⁺(100%).

ethyl [5-(1,7-octadiynyl)-uracil]acetic acid, 7 A solution of compound 6 (1.00 g, 3.3 mmol) and lithium hydroxide (0.28 g, 6.6 mmol) in 2:1 1,4-dioxane:water mixture (9 mL) was stirred for 30 min at room temperature. The reaction was diluted with a 1:1 methanol:water (10 mL) and filtered through a pre-washed Dowex 50 (H⁺) column. The column was washed with methanol (20 mL) and the combined eluents were concentrated under reduced pressure. The residue was purified by column chromatography using dichloromethane graded to 20% methanol in dichloromethane, to provide the acid 7 as an amorphous white solid (0.74 g, 82%). δ_H (300 MHz, DMSO-d₆) 13.19 (1H, s, COOH), 11.61 (1H, s, NH), 7.96 (1H, s, CCH₂), 4.38 (2H, s, NCH₂), 2.76 (1H, t, J = 3 Hz, CH₂CCH), 2.39 (2H, m, CH₂CCH), 2.19 (2H, m, CCCH₂), 1.56 (4H, m, CH₂CH₂CH₂CC); δ_C (75.5 MHz, DMSO-d₆) 169.2 (C), 162.3 (C), 149.9 (C), 148.5 (CH), 97.9 (C), 92.8 (C), 84.2 (C), 72.6 (C), 71.3 (CH), 48.8 (CH₂), 27.2 (CH₂), 27.1 (CH₂), 18.2 (CH₂), 17.2 (CH₂); LRMS-ESI^-: m/z 273.2 [M-H]⁺(100%); HRMS calc. for C₁₆H₁₈N₂NaO₄ 297.0851 found 297.0847.

bis-protected 5-(1,7-octadiynyl)uracil PNA monomer precursor, 8 A solution of the acid 7 (1.32 g, 4.8 mmol), HBTU (1.84 g, 4.8 mmol) and N,N-diisopropylamine (2.5 mL, 13.9 mmol) in N,N-dimethylformamide (6 mL) under argon was stirred at room temperature for 5 min before being added to a solution of compound 4 (2.0 g, 4.6 mmol) in N,N-dimethylformamide (6 mL) under argon. The reaction was stirred at room temperature for 3 h. The solvent was removed under vacuum. Ethyl acetate (200 mL) was added to the residue and the solution was washed with 10% citric acid (100 mL × 2) followed by saturated potassium chloride (100 mL × 1). The organic layer was dried over sodium sulfate and filtered. The filtrate was concentrated in vacuo and purified by flash column chromatography, eluting with dichloromethane graded to 2.5% methanol in dichloromethane. This afforded the title compound as a foam as a mixture of two rotamers (2.75 g, 92%). δ_H (300 MHz, CDCl₃), (2:1 rotamers) 8.88 and 8.92 (3H, s, CONHCO), 7.96 (3H, s, NCH), 7.69 (6H, d, J = 7.4 Hz, ArH), 7.54 (8H, m, ArH and NH), 7.28 (12H, m, ArH), 5.95 and 5.43 (3H, t, J = 7.0 Hz, NHFmoc), 4.42–4.13 (15H, m, OCH₂CH and CH₂COO^tBu), 4.00 and 3.89 (6H, s, NCH₂CO), 3.52–3.28 (12H, m, NCH₂CH₂NHFmoc), 2.34- 2.30 (6H, m, CCCH₂), 2.10–2.18 (6H, m, CH₂CCH), 1.90–1.87 (3H, m, CCH), 1.60–1.55 (12H, m, CH₂CH₂CH₂CCH), 1.44 and 1.40 (27H, s, CH₃); δ_C (75.5 MHz, CDCl₃): 168.7 (C), 162.8 (C), 162.1 (C), 156.7 (C), 149.9 (C), 147.2 (CH), 143.9 (C), 143.8 (C), 141.3 (C), 127.8 (CH), 127.1 (CH), 125.1 (CH), 120.0 (CH), 100.6 (C), 94.7 (C), 71.2 (C), 68.6 (C), 66.7 (CH₂), 51.1 (CH₂), 49.8 (CH₂), 48.9 (CH₂), 48.0 (CH₂), 47.3 (CH), 39.2 (CH), 28.0 (CH₃), 27.5 (CH₂), 27.4 (CH₂), 19.1 (CH₂), 17.9 (CH₂).; LRMS-ESI⁺: m/z 653.3 [M+H]⁺(100%).

alkyne-T-PNA monomer, 1 A solution of compound 8 (3.00 g, 4.6 mmol) in trifluoroacetic acid (9.5 mL), triisopropylsilane (0.25 mL) and water (0.25 mL) was stirred at room temperature for 30 min. The mixture was then added slowly to cold diethyl ether (100 mL) and the resultant solid was filtered and dried overnight under high vacuum to give the product as an amorphous white solid as two rotamers (2.14 g, 78%). δ_H (300 MHz, DMSO-d6), (2:1 rotamers) 12.96 (3H, br.s, COOH), 11.59 (3H, br.s, CONHCO), 7.88 (6H, d, J = 7.5 Hz, ArH), 7.80 (3H, s, NCH), 7.73 and 7.69 (3H, br.s, CONH), 7.68 (6H, d, J = 7.4 Hz, ArH), 7.41 (6H, dd, J = 7.5, 7.1 Hz, ArH), 7.35 (6H, dd, J = 7.5 Hz, 7.1 Hz, ArH), 4.71 and 4.53 (6H, s, CH₂COOH), 4.34–4.23 (9H, m, CH₂CHFmocH), 4.14 and 3.98 (6H, s, NCH₂CO), 3.41–3.11 (12H, m, NCH₂CH₂NH), 2.75 (3H, m, CCH), 2.34 (6H, m, CCCH₂), 2.16 (6H, br.m, CH₂CCH), 1.53 (12H, br.m, CH₂CH₂CH₂CCH); δ_C (75.5 MHz, DMSO-d₆) 170.4 (C), 166.9 (C), 162.3 (C), 156.3 (C), 150.0 (CH), 148.7 (CH), 143.9 (C), 140.7 (C), 127.6 (CH), 127.1 (CH), 125.1 (CH), 120.1 (CH), 97.9 (C), 92.8 (C), 84.2 (C), 72.7 (C), 71.4 (C), 65.5 (CH₂), 47.9 (CH₂), 47.8 (CH₂), 46.8 (CH₂), 46.7 (CH), 40.1 (CH₂), 39.0 (CH), 27.2 (CH₂), 27.1 (CH₂), 18.2 (CH₂), 17.2 (CH₂).; LRMS-ESI^-: m/z 595.3 [M-H]^-(100). HRMS [M+Na]⁺: m/z 619.2171 ; calcd. for C₃₃H₃₂N₄NaO₇ 619.2168.

5-[(tert-butoxycarbonylamino)prop-1-ynyl]uracil acetic acid, 10 To a thoroughly degassed solution of ethyl (5-iodouracil-1-yl)acetate 5 (1.99 g, 6.1 mmol) in anhydrous N,N-dimethylformamide (5 mL) under argon was added successively anhydrous triethylamine (7 mL), tert-butyl prop-2-ynylcarbamate 9 (1.66 g, 10.7 mmol), tetrakis(triphenylphosphine)palladium(0) (0.63 g, 0.5 mmol) and copper (I) iodide (0.21 g, 1.1 mmol). The mixture was left to stir at room temperature. After 2 h the reaction was poured onto a mixture of saturated ammonium chloride (80 mL), aq. EDTA sodium salt (1.2 g in 80 mL water pH 8) and extracted with ethyl acetate (50 mL × 4). The organic fractions were combined and dried over sodium sulfate, filtered and the filtrate was concentrated in vacuo. The residue was co-evaporated with toluene (20 mL × 3), concentrated and purified by flash column chromatography eluting with 10% ethyl acetate in dichloromethane, gradually increasing to 80% ethyl acetate to give the ethyl ester of compound 10 as an amorphous off white powder (1.90 g, 90%). δ_H (300 MHz, DMSO-d₆) 11.74 (1H, s, NHCO), 8.04 (1H, s, NCH), 7.33 (1H, t, J = 5.7 Hz, NHBoc), 4.50 (2H, s, CH₂COOEt), 4.15 (2H, q, J = 7.2 Hz, CH₂CH₃), 3.92 (2H, d, J = 5.7 Hz, CH₂NHBoc), 1.39 (9H, s, CH₃), 1.20 (3H, t, J = 7.2 Hz, CH₂CH₃); δ_C (75.5 MHz, DMSO-d₆) 167.8 (C), 162.0 (C), 155.2 (C), 149.9 (CH), 149.1 (C), 97.4 (C), 90.3 (C), 78.2 (C), 73.4 (C), 61.3 (CH₂), 48.7 (CH₂), 30.0 (CH₂), 28.1 (CH₃), 14.0 (CH₃); LRMS-ESI⁺: m/z 352.4 [M+1]⁺(100). A solution of the ethyl ester (1.93 g, 5.5 mmol) and lithium hydroxide (0.46 g, 10.9 mmol) in methanol:water (3:1, 24 mL) was stirred at room temperature for 45 min. The reaction was filtered through Dowex 50 H⁺ [prewashed with 3 volumes of the following solvents: methanol, water, HCl (1 N), water, 50% pyridine in water and water] and the Dowex was washed with methanol/water (1:1 v/v, 100 mL) to fully recover the product. The eluents were combined and concentrated under high vacuum. The resultant yellow solid was washed with diethyl ether until it became white after which it was dried for 12 h under vacuum to give compound 10 as an amorphous white solid (1.61 g, 91%). δ_H (300 MHz, DMSO-d₆) 13.23 (1H, br.s, COOH), 11.69 (1H, s, CONHCO), 8.03 (1H, s, NCH), 7.32 (1H, br.t, NHBOC), 4.42 (2H, s, CH₂COOH), 3.92 (2H, d, J = 4.8 Hz, CH₂NHBoc), 1.37 (9H, s, CH₃); δ_C (75.5 MHz, DMSO-d₆) 169.2 (2C), 162.1 (C), 155.2 (C), 149.9 (CH), 149.3 (C), 97.2 (C), 90.2 (C), 78.2 (C), 73.6 (C), 61.3 (CH₂), 48.7 (CH₂), 48.6 (CH₂), 30.0 (CH₂), 28.1 (CH₃); LRMS-ESI⁺: m/z 324.5 [M+1]⁺(100); HRMS [M+Na]⁺: m/z 346.1013 ; calcd. for C₁₄H₁₇N₃O₆Na 346.1010.

fully protected 5-(aminoprop-1-ynyl)uracil PNA monomer precursor, 11 A solution of the compound 10 (1.39 g, 4.3 mmol), PyBOP (2.46 g, 4.7 mmol), HOBt (0.06 g, 0.4 mmol) and N,N-diisopropylamine (2.2 mL, 12.9 mmol) in N,N-dimethylformamide (6 mL) was stirred under argon at room temperature for 5 min before being added to a solution of PNA backbone 7 (1.67 g, 3.8 mmol) in N,N-dimethylformamide (6 mL) under argon. The reaction was stirred at room temperature for 3 h after which the solvent was removed under vacuum. Ethyl acetate (150 mL) was added and the resultant solution was washed with 10% citric acid (50 mL × 2) and saturated potassium chloride (50 mL × 2). The organic layer was dried over sodium sulfate, filtered and the filtrate was concentrated in vacuo before being purified by flash column chromatography using 20% ethyl acetate in dichloromethane, gradually increase polarity to 50% ethyl acetate to give compound 11 as an amorphous white powder (two rotamers). (1.711 g, 63%). δ_H (300 MHz, CDCl₃), (2:1 rotamers) 7.75 (9H, d, J = 7.4 Hz, 6ArH and 3NCH), 7.62–7.56 (8H, d, J = 7.4 Hz, 6ArH and 2CONHCO), 7.43–7.28 (16H, m, 12ArH, 3NHBoc and CONHCO), 6.08 and 5.61 (3H, br.t, NHFmoc), 5.01&4.47 (4H, br.s, CH₂COO^tBu), 4.47–4.43&4.34 (11H, m, 3CH₂CH and 2CH₂COO^tBu), 4.21&4.07 (6H, m, CH₂NHBoc), 4.10 and 3.95 (6H, s, CHNCH₂), 3.57–3.35 (12H, m, CH₂CH₂NHFmoc); δ_C (75.5 MHz, CDCl₃) 187.3 (C),162.1 (C), 156.7 (C), 155.4 (C), 148.6 (CH), 143.8 (C), 141.2 (C), 127.8 (CH), 127.1 (CH), 126.3 (CH), 125.2 (CH), 120.1 (CH), 99.2 (C), 90.5 (C), 83.8 (C), 82.7 (C), 80.5 (C), 73.7 (C), 66.7 (CH₂), 51.1 (CH₂), 49.8 (CH₂), 48.8 (CH₂), 48.2 (CH₂), 47.2 (CH), 39.2 (CH₂), 31.2 (CH₂), 28.4 (CH₃), 28.0 (CH₃); LRMS-ESI⁺: m/z 702.1 [M+H]⁺(100).

Fmoc-protected 5-(aminoprop-1-ynyl)uracil PNA monomer precursor, 12 A solution of compound 11 (1.09 g, 1.5 mmol) in trifluoroacetic acid (4.75 mL), triethylsilane (0.13 mL) and water (0.13 mL) was stirred at room temperature for 30 min. The resultant mixture was added slowly to cold diethyl ether (100 mL) and the solid was filtered and dried overnight under high vacuum to give the product as an amorphous white solid (two rotamers) (0.80 g, 95%). δ_H (300 MHz, CDCl₃), (2:1 rotamers) 6.30 (9H, d, J = 8 Hz, ArH and NCH), 6.16 (6H, d, J = 7 Hz, ArH), 5.93–5.80 (12H, m, ArH), 3.38 and 3.14 (6H, s, CH₂COOH), 2.92 and 2.77 (6H, d, J = 6.8 Hz, CH₂CH), 2.75 and 2.63 (3H, br.t, CH₂CH), 2.72 &2.44 (6H, s, CHNCH₂), 2.47–2.02 (6H, m, CH₂NH₂), 2.03–1.83 (12H, m, CH₂CH₂NHFmoc); δ_C (75.5 MHz, CDCl₃) 172.3 (C),169.3 (C), 151.8 (CH), 145.3 (C), 142.6 (C), 128.8 (CH), 128.2 (CH), 126.2 (CH), 121.0 (CH), 98.2 (C), 85.7 (C), 79.6 (C), 67.9 (CH₂), 49.9 (CH₂), 49.3 (CH₂), 49.0 (CH₂), 48.5 (CH), 39.9 (CH₂), 30.8 (CH₂); LRMS-ESI⁺: m/z 546.1 [M+H]⁺(95), 568.2 [M+Na]⁺(100); HRMS [M+Na]⁺: m/z 568.1802 ; calcd. for C₂₈H₂₇N₅O₇Na 568.1803.

aminoalkyl-T-PNA monomer 2 NHS ester 13 was added to a solution of compound 12 (0.34 g, 0.6 mmol) in N,N-dimethylformamide (2 mL) and N,N-diisopropylethylamine (0.32 mL, 1.8 mmol), and the reaction mixture was stirred at room temperature for 4 h. The solvent was concentrated in vacuo, and the product was purified by flash column chromatography using dichloromethane, gradually increase the polarity to 20% methanol in dichloromethane to give the pure compound as amorphous off white powder (rotamers) (0.29 g, 63%). δ_H (300 MHz, DMSO-d6), (2:1 rotamers) 11.62 (3H, br.s, COOH), 8.28 (3H, t, J = 5.0 Hz, CCCH₂NH), 7.88 (6H, d, J = 7.4 Hz, ArH), 7.85 (3H, s, CONHCO), 7.67 (6H, d, J = 7.2 Hz, ArH), 7.58 (3H, br.t, NHFmoc), 7.41 (6H, dd, J = 7.2, 7.5 Hz, ArH), 7.32 (6H, dd, J = 7.4, 7.5 Hz, ArH), 6.75 (3H, t, J = 6.5 Hz, NHBoc), 4.69 and 4.54 (6H, s, CH₂COOH), 4.32 - 4.20 (9H, m, CH₂CH), 4.03 (6H, m, CCCH₂NH), 4.86 and 3.80 (6H, s, CHNCH₂), 3.38–3.13 (9H, m, CH₂CH₂NHFmoc), 2.87 (6H, m, CH₂NHBoc), 2.79–2.73 (3H, m, CH₂CH₂NHFmoc), 2.06 (6H, t, J = 7.5 Hz, CH₂(CH₂)₄NHBoc), 1.41–1.51 (6H, m, CH₂(CH₂)₃NHBoc), 1.36 (27H, s, CH₃), 1.36–1.29 (6H, m, CH₂CH₂NHBoc), 1.23–1.15 (6H, m, CH₂(CH₂)₂NHBoc); δ_C (100.6 MHz, DMSO-d₆) 172.2 (C), 167.8 (C), 162.6 (C), 156.8 (C), 156.0 (C), 150.5 (C), 144.4 (C), 141.2 (C), 128.0 (CH), 127.6 (CH), 125.7 (CH), 120.5 (CH), 97.4 (C), 90.1 (C), 77.7 (C), 74.5 (C), 65.9 (CH₂), 49.1 (CH), 48.5 (CH₂), 48.2 (CH₂), 47.2 (CH₂), 38.4 (CH₂), 35.5 (CH₂), 32.6 (CH₂), 29.7 (CH₂), 28.9 (CH₂), 28.7 (CH₃), 26.5 (CH₂), 25.3 (CH₂) ; LRMS-ESI^-: m/z 757.2 [M-H]^-(100). HRMS [M+Na]⁺: m/z 781.3160; calcd. for C₃₉H₄₆N₆NaO₁₀ 781.3168.

6-(2,2,2-trifluoroacetamido)hexyl 4-methylbenzensulfonate, 15 To a mixture of 6-amino-1-hexanol (5.00 g, 42.7 mmol) was added dimethylaminopyridine (5.20 g, 42.7 mmol) in dichloromethane (215 mL) and ethyl trifluoroacetate (10.2 mL, 85.4 mmol). The reaction mixture was stirred at room temperature and after 1 h was concentrated under vacuum and co-evaporated with toluene (60 mL × 3) to give compound 14 which was dissolved in dichloromethane (215 mL). The mixture was cooled down to 0°C and triethylamine (11.9 mL, 85.4 mmol) and tosyl chloride (16.30 g, 85.4 mmol) were slowly added. The reaction was left to warm up to room temperature and was stirred for a further 5 h. It was then poured onto ice, washed with water (60 mL) and sodium hydrogen carbonate (60 mL × 3), dried over sodium sulfate, concentrated and purified by flash column chromatography, eluting with toluene in hexane (0–100%) to give 6-(2,2,2-trifluoroacetamido)hexyl-4-methylbenzensulfonate 15 as an amorphous solid (11.00 g, 70%). δ_H (400 MHz, DMSO-d₆) 9.41 (1H, s, NH), 7.48 (2H, d, J = 7.5 Hz, ArH), 7.12 (2H, d, J = 7.5 Hz, ArH), 4.25 (2H, t, J = 6.5 Hz, CH₂OS), 3.22–3.10 (2H, m, CH₂NH), 2.29 (3H, s, CH₃), 1.69–1.59 (2H, m, CH₂CH₂OS), 1.54–1.16 (6H, m, CH₂CH₂CH₂CH₂NH); δ_C (100.6 MHz, DMSO-d₆) 155.5 (C), 145.5 (C), 137.7 (C), 128.0 (2CH), 125.4 (2CH), 76.0 (CH₂), 38.9 (CH₂), 28.9 (CH₂), 28.0 (CH₂), 25.5 (CH₂), 24.2 (CH₂), 20.7 (CH₃); ¹⁹F NMR (DMSO-d₆): d ppm -74.35 (CF₃CO-); MS-ESI⁺: m/z 390.2 [M-H]^-.

N-(6-azidohexyl)-2,2,2-trifluoroacetamide, 16 To a mixture of 6-(2,2,2-trifluoroacetamido)hexyl-4-methylbenzensulfonate 15 (5.60 g, 15.2 mmol) in anhydrous N,N-dimethylformamide (40 mL) was added potassium carbonate (3.20 g, 22.8 mmol) and sodium azide (2.0 g, 30.4 mmol). The mixture was stirred at 50°C for 5 h, filtered through a pad of celite and the solvent was removed in vacuo. The residue was co-evaporated with toluene (20 mL × 2), concentrated and purified by flash column chromatography, eluting with toluene in hexane (0–100%) to give N-(6-azidohexyl)-2,2,2-trifluoroacetamide 16 as a yellow oil (3.40 g, 94%). δ_H (400 MHz, DMSO-d₆) 9.36 (1H, s, NH), 3.31 (2H, t, J = 6.8 Hz, CH₂N₃), 3.21–3.13 (2H, m, CH₂NH), 1.57–1.44 (4H, m, CH₂CH₂NH and CH₂CH₂N₃), 1.36–1.22 (4H, m, CH₂CH₂(CH₂)₂N₃); δ_C (400 MHz, DMSO-d₆) 155.0 (C),114.8 (C), 50.4 (CH₂), 39.0 (CH₂), 28.0 (CH₂), 27.9 (CH₂), 25.57 (CH₂), 25.52 (CH₂); δ_F (DMSO-d₆) -74.35 (CF₃CO-); MS-ESI⁺: m/z 237.2 [M+H]⁺; HR-ES [M+Na]⁺: m/z 261.0937 ; calcd. for C₈H₁₃F₃N₄NaO 261.09392.

6-azido-1-aminohexane, 17N-(6-azidohexyl)-2,2,2-trifluoroacetamide 16 (3.30 g, 14.0 mmol) was dissolved in aqueous ammonia solution (35%, 500 mL) and the reaction mixture was stirred for 12 h at room temperature. It was then concentrated to dryness, co-evaporated with methanol (30 mL × 2), redissolved in aqueous methanol (50:50) and passed through a column of Dowex H⁺ form 50W (500 mL) eluting with 3% aqueous ammonia in methanol (1:1). The eluent was collected, the solvent was evaporated and the product was dried under vaccuum overnight to give 6-azido-1-aminohexane 17 as a yellow oil (1.50 g, 76%). δ_H (400 MHz, DMSO-d₆) 7.77 (s, 2H, NH₂), 3.37–3.30 (2H, obsc by residue peak of DMSO, CH₂CH₂N₃), 2.81–2.71 (2H, t, J = 7.5 Hz, CH₂NH₂), 1.59–1.46 (4H, m, CH₂(CH₂)₂CH₂CH₂N₃), 1.35–1.28 (4H, m, CH₂CH₂(CH₂)₂N₃); δ_C (400 MHz, DMSO-d₆) 50.4 (CH₂), 38.8 (CH₂), 27.9 (CH₂), 26.7 (CH₂), 25.5 (CH₂), 25.2 (CH₂); MS-ESI⁺: m/z 143.2 [M+H]⁺; HR-ES [M+H]⁺: m/z 143.1293; calcd. for C₆H₁₅N₄ 143.12967.

di-O-pivaloyl-6-[fluorescein-5-carboxamido]azidohexane, 19 To a solution of di-O-pivaloyl-5(6)-carboxyfluorescein 18 (0.66 g, 1.2 mmol) in anhydrous dichloromethane (12 mL) was added HOBt (0.32 g, 2.4 mmol) and EDC (0.46 g, 2.4 mmol). The reaction mixture was stirred under argon for 5 min, then 6-azido-1-aminohexane 17 (0.17 g, 1.2 mmol) was added. After 1 h the reaction mixture was concentrated and purified by flash column chromatography, eluting with ethyl acetate in hexane (0–40%) to give di-O-pivaloyl-6-[fluorescein-5-carboxamido]azidohexane 19 as a white foam (190 mg, 24%). A small quantity of the impure 6-isomer was also isolated. δ_H (400 MHz, CDCl₃) 8.46 (1H, br. s, ArH), 8.23 (1H, d, J = 8.0 Hz, ArH), 7.26 (1H, d, J = 8.0 Hz, ArH), 7.07 (2H, br. s, ArH), 6.78 (5H, br. s, ArH and NH), 3.48 (2H, t, J = 6.7 Hz, CH₂NH), 3.23 (2H, m, CH₂N₃), 1.70–1.53 (4H, m, 4H, CH₂(CH₂)₂CH₂ CH₂NH), 1.45–1.37 (4H, m, CH₂CH₂(CH₂)₂NH), 1.35 (18H, s, CH₃); δ_C (100.6 MHz, CDCl₃) 176.4 (2C), 168.6 (C), 165.4 (C), 155.1 (C), 152.8 (C), 151.6 (C), 137.1 (C), 135.1 (CH), 128.7 (2CH), 126.4 (C), 124.5 (CH), 123.1 (CH), 117.8 (2CH), 115.5 (2C), 110.4 (2CH), 82.3 (C), 51.3 (CH₂), 40.2 (CH₂), 39.2 (2C), 29.3 (CH₂), 28.7 (CH₂), 27.0 (CH₃), 26.4 (CH₂), 26.3 (CH₂); MS-ESI⁺: m/z 691.8 [M+Na]⁺; HR-ES [M+Na]⁺: m/z 691.2753 ; calcd. for C₃₇H₄₀N₄NaO₈ 691.27438.

5-Azidohexylfluorescein 3 di-O-pivaloyl -6-[fluorescein-5-carboxamido]azidohexane 19 (0.30 g, 0.4 mmol) was dissolved in 1,4-dioxane (30 mL) and concentrated aqueous ammonia (35%, 60 mL) was added. After 3.5 h the reaction mixture was concentrated, co-evaporated with methanol (30 mL × 3) and purified by flash column chromatography, eluting with methanol in dichloromethane (0–30%) with 0.5% trifluoroacetic acid. The product was dissolved in methanol and precipitated by addition of water (15 mL). Drying overnight under vacuum gave compound 3 as an amorphous yellow powder (0.19 g, 93%). δ_Η (400 MHz, DMSO-d₆) 10.14 (2H, s, COOH), 8.79 (1H, t, J = 5.4 Hz, NH), 8.47 (1H,br. s, ArH), 8.25 (1H, d, J = 8.1 Hz, ArH), 7.37 (1H, d, J = 8.1 Hz, ArH), 7.00 (1H, br. s, OH), 6.70 (1H, s, ArH), 6.69 (1H, s, ArH), 6.61–6.52 (4H, m, ArH), 3.39–3.27 (4H, m, CH₂NH and CH₂N₃), 1.62–1.49 (4H, m, CH₂CH₂NH and CH₂CH₂N₃), 1.40–1.31 (4H, m, CH₂CH₂(CH₂)₂NH); δ_C (100.6 MHz, DMSO-d₆) 168.1 (C), 164.4 (C), 159.5 (2C), 154.5 (C), 151.8 (2C), 136.3 (CH), 134.6 (CH), 129.0 (2CH), 126.4 (C), 124.1 (C), 123.1 (CH), 112.6 (2CH), 109.0 (2C), 102.2 (2CH), 83.2 (C), 50.5 (CH₂), 37.8 (CH₂), 28.7 (CH₂), 28.1 (CH₂), 25.9 (CH₂), 25.8 (CH₂); MS-ESI^-: m/z 499.3 [M-H]^-; HR-ES [M+H]⁺: m/z 501.1762; calcd. for C₂₇H₂₅N₄O₆ 501.17741.

Synthesis, purification and analysis of PNA probes

Standard Fmoc PNA monomers and Fmoc Xal resin were purchased from Link Technologies Ltd; piperidine and DMF (peptide synthesis grade) were purchased from Rathburn; HATU and amino acids were bought from Novabiochem and CEM Ltd; DIPEA, 2,6-lutidine, acetic anhydride, trifluoroacetic acid (TFA) and triisopropylsilane (TIS) were bought from Sigma Aldrich. All the PNA oligomers were synthesized on an Expedite Nucleic Acid/PNA synthesizer on the 2 μmole scale. Cleavage and deprotection of the PNA was performed using TFA:water:TIS in a ratio of 95:2.5:2.5 (400 μL/2 μmole) for 20 min. Purification of PNA was performed by reversed-phase HPLC on a Gilson system using an Ascentis C18 (Supelco) column, 10 mm × 250 mm, pore size 10 micron. The following protocols were used: Run time 35 min, flow rate 3 mL per min, binary system, gradient: Time in min (% buffer B); 0 (5); 5 (5); 24 (30); 26 (95); 29 (95); 30 (5); 35 (5). Elution buffer A: 0.1% TFA in water and buffer B: 0.08%TFA in acetonitrile. Elution of PNAs was monitored by UV absorption at 295nm. PNAs were then freeze-dried and re-dissolved in water at working concentration. The molecular mass of the PNAs was verified by a Low Resolution MALDI-TOF MS on a Waters (micromass) TofSpec2E 337 nm laser operating in linear mode with external calibration of +/− 0.1%..

General procedure for solution phase click chemistry

A solution of CuSO₄ in water (100 nmol / μL) was degassed by purging with argon gas and added to a degassed solution of sodium ascorbate (500 nmol / μL) in water. The mixture was degassed one more time before being added to a degassed solution of PNA in water. The 5-azidohexylfluorescein 3 in THF was added to the reaction mixture and the resultant mixture was degassed and left in the dark at room temperature for 2 h. THF 1 mL was added and the solution was centrifuged at 5000 rpm for 2 min. The supernatant was removed and the pellet was re-dissolved in 0.1% TFA in water. The product was purified by reverse phase HPLC. Note: The final concentration of PNA in the reaction was less than 0.2 mM, the ratio of water to THF was ~1:1) The molar ratio of PNA:CuSO₄:sodium ascorbate:dye was 1:10:100:50.

General procedure for solid phase click chemistry

Use similar condition as for solution phase labeling, a solution of CuSO₄ was added to a degassed solution of sodium ascorbate. The reaction was degassed one more time before being added to the PNA resin in DMF under argon. Then a solution of degassed dye in DMF was added to the reaction mixture under argon and the mixture was left at room temperature for 2 h. The resin was transfer to an ALL-FIT column (Link Technologies Ltd) and washed with DMF (4 × 1 mL), DCM (3 × 1mL) and diethyl ether (2 × 1mL). The resin was dried under a stream of argon gas for 10 min before cleavage using the same conditions as for the PNA probe synthesis.

PCR amplification and fluorescence melting analysis

Target amplification and melting curve analysis was performed using a Roche LightCycler^® 1.5 instrument in single experiment. Reactions were performed in 10 μL reaction volumes, comprising 0.5 μM of reverse primer (RP), 0.05 μM of forward primer (FP), 0.5 mM dNTPs, 0.1 μM of the probe, 3.0 mM of MgCl₂, 10 ng / µL BSA (Roche Diagnostics, Lewes, UK), 0.5 Units HotStarTaq (QIAGEN, Crawley, UK) and 4 ng of the DNA targets. The PCR thermal cycling conditions were 95°C for 15 min to activate the enzyme followed by 35 cycles of 94°C / 10 sec, 50°C / 15 sec and 72°C / 15 sec. Following amplification, reactions were heated to 95°C for 30 sec and cooled at 30°C for 1 min. Melting curve analysis was then performed by heating reactions from 30°C to 95°C at 0.1°C /sec. The fluorescence melting curve data were converted to the first derivatives giving the melting peaks (-d(F)/dT where F is fluorescence and T is temperature in°C). The total time of the amplification and melting curve analysis was on average 60 min and depended on the ambient temperature, i.e., ability of LightCycler^® to cool to 30°C.

Oligonucleotide synthesis and purification

Oligonucleotides, including HyBeacons, were synthesized by standard methods.²⁰

Acknowledgments

The authors wish to thank Julie M. Herniman for helping with MS analyses.

Glossary

Abbreviations:

Boc	tert-butyloxycarbonyl
^tBu	tert-butyl
CuAAC	copper (I) catalysed alkyne azide cycloaddition
DCM	dichloromethane
DIPEA	diisopropylethylamine
DMAP	4-diamethylaminopyridine
DMF	N,N-dimethylformamide
EDC	1-ethyl-3-(3-dimethylaminopropyl)carbodiimide
EDTA	ethylenediaminetetraacetic acid
FAM	fluorescein
HATU	O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate
HBTU	O-benzotriazole-N,N,N’,N’-tetramethyluronium hexafluorophosphate
HOBt	1-hydroxybenztriazole
hr	hour
NHS	N-hydroxysuccinimidyl
PCR	polymerase chain reaction
Piv	pivaloyl
PNA	peptide nucleic acid
PyBOP	benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate
RP HPLC	reversed-phase HPLC
rt	room temperature
SNP	single nucleotide polymorphism
TFA	trifluoroacetic acid
THF	tetrahydrofuran
TIS	triisopropylsilane
TLC	thin layer chromatography
T_m	melting temperature
Tosyl	p-toluenesulfonyl
UV	ultraviolet

Footnotes

Previously published online: www.landesbioscience.com/journals/artificialdna/article/18179

References

1. Ranasinghe RT, Brown T. Fluorescence based strategies for genetic analysis. Chem Commun (Camb) 2005:5487–502. doi:10.1039/b509522k. [PubMed] [CrossRef] [Google Scholar]

2. Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genome Res. 1996;6:986–94. doi:10.1101/gr.6.10.986. [PubMed] [CrossRef] [Google Scholar]

3. Whitcombe D, Theaker J, Guy SP, Brown T, Little S. Detection of PCR products using self-probing amplicons and fluorescence. Nat Biotechnol. 1999;17:804–7. doi:10.1038/11751. [PubMed] [CrossRef] [Google Scholar]

4. Tyagi S, Kramer FR. Molecular beacons: Probes that fluoresce upon hybridization. Nat Biotechnol. 1996;14:303–8. doi:10.1038/nbt0396-303. [PubMed] [CrossRef] [Google Scholar]

5. Vossen RH, Aten E, Roos A, den Dunnen JT. High-Resolution Melting Analysis (HRMA)-More Than Just Sequence Variant Screening. Hum Mutat. 2009;30:860–6. doi:10.1002/humu.21019. [PubMed] [CrossRef] [Google Scholar]

6. French DJ, Archard CL, Brown T, McDowell DG. HyBeacon (TM) probes: a new tool for DNA sequence detection and allele discrimination. Mol Cell Probes. 2001;15:363–74. doi:10.1006/mcpr.2001.0384. [PubMed] [CrossRef] [Google Scholar]

7. Nicklas JA, Buel E. A Real-Time Multiplex SNP Melting Assay to Discriminate Individuals. J Forensic Sci. 2008;53:1316–24. [PubMed] [Google Scholar]

8. Erali M, Voelkerding KV, Wittwer CT. High resolution melting applications for clinical laboratory medicine. Exp Mol Pathol. 2008;85:50–8. doi:10.1016/j.yexmp.2008.03.012. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

9. Ratilainen T, Holmen A, Tuite E, Nielsen PE, Norden B. Thermodynamics of sequence-specific binding of PNA to DNA. Biochemistry. 2000;39:7781–91. doi:10.1021/bi000039g. [PubMed] [CrossRef] [Google Scholar]

10. Kolb HC, Finn MG, Sharpless KB. Click chemistry: Diverse chemical function from a few good reactions. Angew Chem Int Ed Engl. 2001;40:2004–21. doi:10.1002/1521-3773(20010601)40:11<2004::AID-ANIE2004>3.0.CO;2-5. [PubMed] [CrossRef] [Google Scholar]

11. Hüsken N, Gasser G, Koster SD, Metzler-Nolte N. “Four-Potential” Ferrocene Labeling of PNA Oligomers via Click Chemistry. Bioconjug Chem. 2009;20:1578–86. doi:10.1021/bc9001272. [PubMed] [CrossRef] [Google Scholar]

12. Giusti WG, Adriano T. Synthesis and Characterization of 5′-Fluorescent-dye-labeled Oligonucleotides. PCR Methods Appl. 1993;2:223–7. doi:10.1101/gr.2.3.223. [PubMed] [CrossRef] [Google Scholar]

13. El-Sagheer AH, Brown T. Click chemistry with DNA. Chem Soc Rev. 2010;39:1388–405. doi:10.1039/b901971p. [PubMed] [CrossRef] [Google Scholar]

14. Link E, Parish S, Armitage J, Bowman L, Heath S, Matsuda F, et al. SLCO1B1 variants and statin-induced myopathy - A genomewide study. N Engl J Med. 2008;359:789–99. doi:10.1056/NEJMoa0801936. [PubMed] [CrossRef] [Google Scholar]

15. f*ckuyama T, Cheung M, Jow CK, Hidai Y, Kan T. 2,4-dinitrobenzenesulfonamides: A simple and practical method for the preparation of a variety of secondary amines and diamines. Tetrahedron Lett. 1997;38:5831–4. doi:10.1016/S0040-4039(97)01334-8. [CrossRef] [Google Scholar]

16. Ball RJ, Green PS, Gale N, Langley GJ, Brown T. Peptide Nucleic Acid Probes with Charged Photocleavable Mass Markers Towards PNA-based MALDI-TOF MS Genetic Analysis. Artif DNA PNA XNA. 2010;1:27–35. doi:10.4161/adna.1.1.12199. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

17. Casara P, Darwin C, Metcalf B, Jung M. Stereospecific synthesis of (2R,5R)-hept-6-yne-2,5-diamine: a potent and selective enzyme-activated irreversible inhibitor of ornithine decarboxylase (ODC). Chem Soc. Perkin Trans. 1985;1:2201–7. [Google Scholar]

18. Ross SA, Pitie M, Meunier B. Synthesis of two acridine conjugates of the bis(phenanthroline) ligand “clip-phen” and evaluation of the nuclease activity of the corresponding copper complexes. Eur J Inorg Chem. 1999:557–63. doi:10.1002/(SICI)1099-0682(199903)1999:3<557::AID-EJIC557>3.0.CO;2-Y. [CrossRef] [Google Scholar]

19. Adamczyk M, Chan CM, Fino JR, Mattingly PG. Synthesis of 5-and 6-hydroxymethylfluorescein phosphoramidites. J Org Chem. 2000;65:596–601. doi:10.1021/jo991449h. [PubMed] [CrossRef] [Google Scholar]

20. Gale N, French DJ, Howard RL, McDowell DG, Debenham PG, Brown T. Rapid typing of STRs in the human genome by HyBeacon (R) melting. Org Biomol Chem. 2008;6:4553–9. doi:10.1039/b813431f. [PubMed] [CrossRef] [Google Scholar]

Articles from Artificial DNA, PNA & XNA are provided here courtesy of Taylor & Francis